lunes, 27 de marzo de 2006

Chim póm

¡Bueno, se acabó el veintiseis de marzo! Volvemos al trabajo, gente. ¡ODIO AL MUNDO! Desde el cariño, pero lo odio.

Pero antes de continuar... una terrible duda existencial que me surgió el otro día. Vamos a ver, os cuento: hace unos cuatro días, creo recordar que fue, fui asaltado en plena calle por un testigo de Jehová. Para los que nunca hayáis pasado por esta situación, os lo describo: son los únicos con los que no funciona la respuesta "Es que soy estudiante" para que te dejen en paz. Eso sí, siempre tienen la delicadeza de preguntar primero "¿Le pillo con prisa?", dándote la oportunidad de escapar; pero claro, ya que ellos han tenido esa delicadeza, no vas a ser tú ahora el borde que le diga "pues sí, mire usted..."

Y a partir de ahí, el testigo de Jehová te empieza a hablar del paraíso que Dios va a construir en la Tierra. Y te dice que él y los suyos se dedican a hacer lo mismo que hicieron Cristo y sus apóstoles. Que tú ahí dices "Vale, predicar la palabra, de acuerdo; porque como se refiera a organizar cenitas en plan Agatha Christie para ver si Judas confiesa, entonces me estás diciendo que lo único que hacéis es reuniros por las tardes para jugar al Cluedo, y en ese caso ¿DÓNDE HAY QUE FIRMAR?". Todo la mar de bien argumentado, sabes perfectamente que no tienes por qué creértelo y que en cuanto te vuelva a dar una oportunidad de escapar la vas a aprovechar.

Pero yo decidí contestarle.

Así las cosas, cuando el tío me dijo que no hay nadie perfecto salvo Adán, Eva y Cristo, y después de haberme dicho ya alguna que otra vez que la Biblia tiene todas las respuestas, yo pensé "pues qué coño, acudamos a ese libro maravilloso que lo sabe todo". De Adán y Eva pensé que mejor no le hablaba, que esa era demasiado fácil. Así que fui directamente a por Cristo.

Básicamente lo que le dije fue algo tal que así: "Si me permite una reflexión, caballero, y es sólo una reflexión... Yo no creo que Cristo fuese perfecto. Piense que, hacia el final de la historia, y la Biblia lo recoge, Cristo culpaba a Dios por todo su sufrimiento y estuvo a punto de perder la fé. Cristo era el hijo de Dios, vale, pero era humano, normal, vulnerable. Así que yo sostengo que quizás lo que lo hacía especial era, precisamente, su imperfección: siendo como era un ser capaz de cometer errores, trató de hacer toda su vida lo que le parecía que era lo correcto".

¡Me acabó dando la razón, el tío! Así que cambió su argumentación a "ninguno de nosotros somos perfectos, pero tenemos que hacer todo lo que podamos". Perfecto, otro dato BIBLIOgráfico que tirarle a la cara. Inmediatamente le contesto: "Hombre, eso está claro; si no fíjese en Noé, que era un borracho y mire lo que fue capaz de hacer".

En mi defensa diré que, cuando me dijo "¿qué mejor ejemplo que Cristo, que hizo cosas que nadie más ha podido hacer, como controlar a los vientos o caminar sobre las aguas?", lo dejé marchar sin contestarle "pero gilipollas, si eso es completamente imposible para nadie que no sea directamente el hijo de Dios, ¿no le parece que, si Cristo es un ejemplo a seguir, será por TODO LO HUMANAMENTE POSIBLE QUE SÍ HIZO?", porque pensé que bastante tiene que ser el constante rechazo de la gente que se lo encuentra por la calle como para encima desmoronarle todo su sistema de creencias. También evité la tentación de presentarme como miembro de la Orden Hospitalaria de los Hermanos de Abel, porque no tenía ganas de inventarme una explicación de dicha orden.

A la vista de todos esos acontecimientos, lo someto a votación: ¿creéis que iré al infierno mucho o poco?

EL ODIO HA VUELTO. Que me voy un día y esto se descontrola.

4 comentarios:

Dhyrxios dijo...

bUENO MI PUNTO DE VITA TOTALMENTE Y EXAGERADAMENTE NORMAL ES LA SIGUIENTE:YO NO VI NINGUN ACCIDENTE POR LO TANTO MENOS AUN VOY A VER TALES TESTIGOS SOBRE DIOS,BUENO FUE EL PRIMER ANARKISTA QUE TUVO LA HISTORIA DE LA HUMANIDAD O POR LO MENOS ASI ES COMO SE LE LLAMA AL PERSONAJE QUE VA CON LOS PELOS LARGOS CON BARBA DE TRES SEMANAS REVINDICANDO EL GOBIERNO SOMETIENDO AL PUEBLO A UNA HUELGA Y SIN QUERER TRABAJAR.
PERO BUENO TENIENDO EN CUENTA QUE SU PADRE HACIA "COPITAS" Y SU MADRE MANTENIA RELACIONES SEXUALES CON UN TAL ESPIRITUD SANTO NO ME ESTRAÑA.
A TU PREGUNTA TE DIGO QUE.......¿PUEDO PEDIR EL COMODIN DEL PUBLICO?POR CIERTO A TI QUE TE GUSTAN LAS ABREVIATURAS AKY TIENES UNA
"NUMVNUVSH"
TE JURO QUE SIGNIFICA ALGO Y QUE NO ES NADA INVENTADO


P.D. UNA PISTA LA FRASE ES DE NADA

Kiki dijo...

Me habeis traumado de por vida...yo era catolico hasta hace 5 min...bueno la verdad no, los tesytigos de jehova son muy utiles...sin ellos la mitad de mis chistes no tendrian sentido, ahi va uno de regalo:

-en que se parecen un testigo de jehova y un fiat 600 oxidado?
- que en ambos casos es realmente jodido cerrar la puerta!.

TCACHMA!

Jack dijo...

Dhyrxios, por el amor de Francisco Javier... (el testigo en cuestión)

... Ni Una Muerte Vana, Ni Una Vida Sin Honor. Está claro.

Y una vez que he saludado con una frsae bonita, allá va la traducción: Ehm... "Nuestro Urólogo Mañana Vendrá, No Usará Vendajes Sobre Herpes".

Hala, acojonaos pa tres días.

Dhyrxios dijo...

gggguuuuuuuaaaaaaauuuuuuuuuu